SubtiBank SubtiBank
ktrA [2019-05-08 09:46:50]
You are currently viewing an outdated version of SubtiWiki. Please use the newest version!

ktrA [2019-05-08 09:46:50]

high affinity potassium channel KtrA-KtrB, peripheric membrane component
Locus
BSU31090
Isoelectric point
5.98
Molecular weight
24.73 kDa
Protein length
222 aa Sequence Blast
Gene length
669 bp Sequence Blast
Function
potassium uptake
Product
high affinity potassium channel KtrA-KtrB, peripheric membrane component
Essential
no
Synonyms
yuaA

Genomic Context

      
Loading

Categories containing this gene/protein

Gene

Coordinates
3,188,414 3,189,082

Phenotypes of a mutant

  • a kimA ktrA ktrB mutant requires high potassium concentrations on minimal medium with ammonium as nitrogen source PubMed
  • a ktrA-ktrB mutant of B. subtilis NCIB3610 is reduced in sliding (dendritic spreading) PubMed
  • The protein

    Protein family

  • KtrA potassium transport family (with KtrC, according to UniProt)
  • Paralogous protein(s)

    Kinetic information

  • the KtrA-KtrB channel has a high affinity for potassium,this is determined by KtrB PubMed
  • Domains

  • contains a RCK_N domain at the N-terminus (according to UniProt)
  • contains a RCK_C domain at the C-terminus (according to UniProt)
  • Effectors of protein activity

  • binds ADP and ATP PubMed
  • Structure

  • 4J7C (the KtrA-KtrB complex) PubMed
  • 4XTT (the S. aureus KtrA RCK_C domain in complex with c-di-AMP, 48% identity) PubMed
  • 1LSU (complex with NADH)
  • 2HMW ( complex with ATP)
  • Localization

  • peripheral membrane protein PubMed
  • Expression and Regulation

    Operons

    Genes
    Description

    Regulatory mechanism

  • ydaO riboswitch: termination/antitermination, expression is switched off upon binding of c-di-AMP, in ydaO riboswitch
  • view in new tab

    Additional information

  • growth at extreme potassium limitation results in the acquisition of promoter mutations with increased ktrA-ktrB expression PubMed
  • Biological materials

    Mutant

  • MGNA-B543 (yuaA::erm), available at the NBRP B. subtilis, Japan
  • 1A954 ( ktrA::kan), PubMed, available at BGSC
  • GHB1 (ktrA-ktrB::aphA3), available in Erhard Bremer's lab
  • GP92 (ktrA-ktrB::aphA3), available in Jörg Stülke's lab PubMed
  • GP2083 (ktrA-ktrB::aphA3 ktrC::tet), available in Jörg Stülke's lab PubMed
  • GP2498 (ktrA-ktrB::spc kimA::cat), available in Jörg Stülke's lab
  • BKE31090 (ktrA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAATGTTCATATCTCCCTTA, downstream forward: _UP4_GAAAACGAAGGGATGTAGAC
  • BKK31090 (ktrA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAATGTTCATATCTCCCTTA, downstream forward: _UP4_GAAAACGAAGGGATGTAGAC
  • GP2716 (ktrA-ktrB::spc), available in Jörg Stülke's lab
  • GP3065 (ktrA::kan), available in Jörg Stülke's lab
  • Expression vectors

  • pGP2594: (IPTG inducible expression, purification in E. coli with N-terminal His-tag, in pWH844), available in Jörg Stülke's lab
  • LacZ fusion

  • GP2176 (based on pAC5), available in Jörg Stülke's lab
  • GP2177 (based on pAC7), available in Jörg Stülke's lab
  • GP2299 (based on pAC6), available in Jörg Stülke's lab PubMed
  • References

    Reviews

    Loading

    Original publications

    Loading

    Labs working on this gene/protein

  • Erhard Bremer, University of Marburg, Germany homepage